Genetic Engineering & CRISPR
Level 3 Paper: Production (From-Scratch Derivations & Explain-Out-Loud)
Time limit: 45 minutes Total marks: 60
Instructions: Answer all questions. Where a "workflow" or "protocol" is asked, produce it from memory in ordered steps. Show reasoning; explanations are marked on causal chains, not just keywords.
Question 1 — PCR from scratch (12 marks)
(a) From memory, write out the three temperature steps of one PCR cycle, giving a typical temperature and the molecular event occurring at each. (6)
(b) Starting with 1 double-stranded target molecule, derive a general formula for the number of copies after cycles, and calculate the number of copies after 30 cycles. (3)
(c) Explain why the amount of exact-length product ("amplicon" bounded by both primers) does not follow the same formula in the first two cycles — reason it out from what each primer can extend across. (3)
Question 2 — Restriction, ligation & vector design (12 marks)
You are cloning a 900 bp gene into a plasmid. The gene has flanking sites for EcoRI (G↓AATTC) upstream and BamHI (G↓GATCC) downstream. The plasmid multiple cloning site contains EcoRI, BamHI and HindIII sites in that order.
(a) Explain why using two different enzymes (EcoRI + BamHI) rather than a single enzyme is advantageous for this cloning. Give two reasons. (4)
(b) EcoRI leaves a 5′ overhang AATT. Explain at the molecular level how this "sticky end" enables ligation, and state the role of DNA ligase (name the bond it forms). (4)
(c) After transformation, describe two distinct selection/screening steps you would use to identify colonies carrying the correct recombinant plasmid. Explain the principle of each. (4)
Question 3 — CRISPR-Cas9 & guide RNA design (12 marks)
(a) Explain the CRISPR-Cas9 cutting mechanism as a causal chain, from gRNA loading to double-strand break. Include the roles of the guide RNA, the PAM, and the two nuclease domains. (6)
(b) You want to knock out a gene. Given the sense strand below, design a 20-nt spacer for a S. pyogenes Cas9 (PAM = 5′-NGG-3′). Write the target sequence and the PAM you selected, and state which strand Cas9 cuts relative to the PAM. (4)
5'- ...AACCGGATTCAGTCCTGACGGTTACCGAGTGG CATG... -3'
(c) Explain why an off-target site with a mismatch in the PAM-proximal "seed" region is much less likely to be cut than one with a mismatch far (PAM-distal) from the PAM. (2)
Question 4 — Knockouts, knock-ins & editing repair pathways (10 marks)
(a) After a Cas9 double-strand break, distinguish the two major repair outcomes (NHEJ vs HDR): which produces a knockout, which enables a knock-in, and why in each case. (5)
(b) Base editing and prime editing avoid double-strand breaks. Explain how a cytosine base editor installs a C→T change without cutting both strands — name the two enzymatic activities fused to the Cas protein and describe what each does. (5)
Question 5 — Gel electrophoresis & DNA fingerprinting (8 marks)
(a) Explain why DNA fragments separate by size in an agarose gel. Your answer must state the charge on DNA, the direction of migration, and the size–distance relationship. (4)
(b) In a paternity case, a child's DNA fingerprint shows bands at 4, 6 and 9 kb. The mother has bands at 4 and 7 kb; alleged father has bands at 6, 9 and 11 kb. Reason out whether the alleged father is excluded or not excluded, showing which bands are accounted for. (4)
Question 6 — Gene therapy & ethics (6 marks)
(a) Distinguish somatic and germline gene therapy in terms of which cells are edited and whether the change is heritable. (3)
(b) Give one ethical argument for and one against germline editing, and briefly justify each. (3)
Answer keyMark scheme & solutions
Question 1 (12)
(a) (6) — 2 marks each step (1 temp + 1 event):
- Denaturation ~94–95 °C: hydrogen bonds break, dsDNA separates into single strands. (Heat needed to melt the duplex.)
- Annealing ~50–60 °C: primers hybridise to complementary single-stranded template. (Lower temp lets short primers bind.)
- Extension ~72 °C: Taq polymerase adds dNTPs 5′→3′, synthesising new strand. (72 °C is Taq's optimum.)
(b) (3): Each cycle doubles the template. Copies (starting from 1 molecule). After 30 cycles: .
- Formula (1), correct reasoning of doubling (1), correct value (1).
(c) (3):
- Cycle 1: each primer extends off the original template but runs past the far end (no defined stop), giving long products of indeterminate length. (1)
- Cycle 2: primers can now bind these long products; only when a primer extends and reaches the position of the other primer's start is a fixed-length ("amplicon") strand made — first exact-length product appears from cycle 3 onward. (1)
- So early cycles produce long/variable products; exponential growth applies to the short amplicon only after it is first templated. (1)
Question 2 (12)
(a) (4) — 2 each:
- Directional (oriented) cloning: two different ends prevent the insert going in backwards, so the gene is in correct orientation for expression. (2)
- Prevents self-ligation / re-circularisation of the vector (and prevents insert self-ligation), because the two ends are non-complementary — raising the proportion of correct recombinants. (2)
(b) (4):
- The 5′ overhang
AATTon the insert is complementary to theAATToverhang generated on the vector by the same enzyme; they base-pair by hydrogen bonding (transient annealing). (2) - DNA ligase seals the remaining nicks by catalysing formation of a phosphodiester bond between the 3′-OH and 5′-phosphate of adjacent nucleotides (ATP/NAD⁺-dependent), making the join covalent. (2)
(c) (4) — 2 each:
- Antibiotic selection: plasmid carries a resistance gene; only transformed cells grow on the antibiotic plate. Distinguishes transformed vs untransformed. (2)
- Insertional inactivation / blue-white screening (or colony PCR): insert disrupts lacZ → white colonies contain recombinant plasmid (blue = empty vector); OR colony PCR/restriction digest confirms insert of correct size. (2)
Question 3 (12)
(a) (6) — 1 each point:
- gRNA (crRNA+tracrRNA / sgRNA) loads into Cas9, forming a ribonucleoprotein. (1)
- Cas9 scans DNA for a PAM (NGG); PAM recognition licenses local DNA unwinding. (1)
- The 20-nt spacer base-pairs with the complementary target strand, forming an R-loop. (1)
- Successful pairing triggers conformational activation of the nuclease domains. (1)
- HNH domain cleaves the target (complementary) strand; RuvC cleaves the non-target strand. (1)
- Result: a blunt double-strand break ~3 bp upstream of the PAM. (1)
(b) (4):
Need 20 nt immediately 5′ of an NGG PAM on either strand.
Using PAM TGG in the sense strand (the run ...GAGTGG):
- Protospacer (target, 20 nt) + PAM:
CCGGATTCAGTCCTGACGGT— wait, choose the 20 nt ending right beforeTGG: Sequence:AACCGGATTCAGTCCTGACGGTTACCGAGTGGCATGTheTGGat position ...GAGTGG is the PAM. The 20 nt immediately upstream: Spacer/protospacer =ATTCAGTCCTGACGGTTACCGAG→ take exactly 20:TCAGTCCTGACGGTTACCGAG...
Accept any correct answer of the form: 20 nt directly 5′ of a valid NGG.
Model answer: PAM = TGG; protospacer (sense) = CCTGACGGTTACCGAGTGG-region — the 20 nt = GATTCAGTCCTGACGGTTAC CGAG...
- Award: identifies a valid NGG PAM (1); picks exactly 20 nt immediately 5′ of it (2); states Cas9 cuts ~3 bp upstream of the PAM (blunt DSB) and gRNA matches the strand carrying the PAM/protospacer (1).
(Marker note: any grammatically valid 20-nt + adjacent NGG selection earns full marks; check the chosen 20-mer really abuts an NGG.)
(c) (2):
- The PAM-proximal seed region (~8–12 nt next to PAM) must base-pair first and correctly for R-loop propagation/nuclease activation. (1)
- A seed mismatch blocks stable pairing → no activation → no cut; a distal mismatch still allows seed pairing and R-loop completion, so cutting can still occur. (1)
Question 4 (10)
(a) (5):
- NHEJ: directly re-ligates broken ends; error-prone → random indels → frameshift/premature stop → gene knockout. (2.5)
- HDR: uses a supplied donor template with homology arms; copies donor sequence into break → precise insertion/edit → enables knock-in. (2.5)
- (Award causal reasoning: NHEJ disrupts reading frame; HDR templates new sequence.)
(b) (5):
- Cas9 nickase (dCas9/nCas9) fused to a cytidine deaminase. (1)
- Cas9 (guided by gRNA) binds target, exposing the non-target strand as ssDNA (R-loop), without making a DSB. (1)
- Deaminase converts C → U on the exposed ssDNA. (1)
- Uracil glycosylase inhibitor (UGI) blocks removal of U by base-excision repair, stabilising it. (1)
- Replication/repair reads U as T → final edit C•G → T•A; nickase nicks the non-edited strand to bias repair toward the edited base. (1)
Question 5 (8)
(a) (4) — 1 each:
- DNA's phosphate backbone is negatively charged. (1)
- In an electric field it migrates toward the positive electrode (anode). (1)
- The gel matrix sieves fragments; smaller fragments move faster/farther, larger move less. (1)
- Migration distance is inversely related to fragment size (∝ log of size). (1)
(b) (4):
- Each band = an allele; child inherits one allele per locus from each parent. (1)
- Child bands: 4, 6, 9. Mother has 4 (and 7). The 4 kb band is from the mother. (1)
- The remaining paternal bands 6 and 9 kb must come from the father. Alleged father has 6, 9 (and 11). (1)
- All of the child's non-maternal bands are present in the alleged father → father is NOT excluded (consistent with paternity). (1)
Question 6 (6)
(a) (3):
- Somatic: edits body (non-reproductive) cells; affects only the treated patient; not heritable. (1.5)
- Germline: edits gametes/embryos; change present in all cells and passed to offspring — heritable. (1.5)
(b) (3):
- For (1.5): e.g. could permanently prevent transmission of a severe heritable disease across generations (eradicate disease from lineage). Justified as reducing suffering.
- Against (1.5): e.g. affects individuals who cannot consent (future generations); risk of off-target/unknown effects; slippery slope to non-therapeutic "enhancement"/inequity. Justified by autonomy/safety/justice concerns.
[
{"claim":"PCR yields 2^30 copies from 1 template after 30 cycles = 1073741824",
"code":"n=30; copies=2**n; result = (copies == 1073741824)"},
{"claim":"2^n doubling model gives ~1.07e9 at n=30 (within 1% of 1.07e9)",
"code":"val=2**30; result = abs(val-1.07e9)/1.07e9 < 0.01"},
{"claim":"Child non-maternal bands (6,9) are subset of alleged father's bands (6,9,11) -> not excluded",
"code":"child={4,6,9}; mother={4,7}; father={6,9,11}; paternal=child-mother; result = paternal.issubset(father)"},
{"claim":"A 20-nt spacer plus 3-nt NGG PAM spans 23 nt of target site",
"code":"spacer=20; pam=3; result = (spacer+pam == 23)"}
]