Genetic Engineering & CRISPR

Question 1 (12)

(a) (6) — 2 marks each step (1 temp + 1 event):

• Denaturation ~94–95 °C: hydrogen bonds break, dsDNA separates into single strands. (Heat needed to melt the duplex.)
• Annealing ~50–60 °C: primers hybridise to complementary single-stranded template. (Lower temp lets short primers bind.)
• Extension ~72 °C: Taq polymerase adds dNTPs 5′→3′, synthesising new strand. (72 °C is Taq's optimum.)

(b) (3): Each cycle doubles the template. Copies $= 2^n$ (starting from 1 molecule). After 30 cycles: $2^{30} = 1{,}073{,}741{,}824 \approx 1.07\times10^9$.

• Formula $2^n$ (1), correct reasoning of doubling (1), correct value (1).

(c) (3):

• Cycle 1: each primer extends off the original template but runs past the far end (no defined stop), giving long products of indeterminate length. (1)
• Cycle 2: primers can now bind these long products; only when a primer extends and reaches the position of the other primer's start is a fixed-length ("amplicon") strand made — first exact-length product appears from cycle 3 onward. (1)
• So early cycles produce long/variable products; exponential $2^n$ growth applies to the short amplicon only after it is first templated. (1)

Question 2 (12)

(a) (4) — 2 each:

• Directional (oriented) cloning: two different ends prevent the insert going in backwards, so the gene is in correct orientation for expression. (2)
• Prevents self-ligation / re-circularisation of the vector (and prevents insert self-ligation), because the two ends are non-complementary — raising the proportion of correct recombinants. (2)

(b) (4):

• The 5′ overhang AATT on the insert is complementary to the AATT overhang generated on the vector by the same enzyme; they base-pair by hydrogen bonding (transient annealing). (2)
• DNA ligase seals the remaining nicks by catalysing formation of a phosphodiester bond between the 3′-OH and 5′-phosphate of adjacent nucleotides (ATP/NAD⁺-dependent), making the join covalent. (2)

(c) (4) — 2 each:

• Antibiotic selection: plasmid carries a resistance gene; only transformed cells grow on the antibiotic plate. Distinguishes transformed vs untransformed. (2)
• Insertional inactivation / blue-white screening (or colony PCR): insert disrupts lacZ → white colonies contain recombinant plasmid (blue = empty vector); OR colony PCR/restriction digest confirms insert of correct size. (2)

Question 3 (12)

(a) (6) — 1 each point:

1. gRNA (crRNA+tracrRNA / sgRNA) loads into Cas9, forming a ribonucleoprotein. (1)
2. Cas9 scans DNA for a PAM (NGG); PAM recognition licenses local DNA unwinding. (1)
3. The 20-nt spacer base-pairs with the complementary target strand, forming an R-loop. (1)
4. Successful pairing triggers conformational activation of the nuclease domains. (1)
5. HNH domain cleaves the target (complementary) strand; RuvC cleaves the non-target strand. (1)
6. Result: a blunt double-strand break ~3 bp upstream of the PAM. (1)

(b) (4): Need 20 nt immediately 5′ of an NGG PAM on either strand. Using PAM TGG in the sense strand (the run ...GAGTGG):

• Protospacer (target, 20 nt) + PAM: CCGGATTCAGTCCTGACGGT — wait, choose the 20 nt ending right before TGG: Sequence: AACCGGATTCAGTCCTGACGGTTACCGAGTGGCATG The TGG at position ...GAGTGG is the PAM. The 20 nt immediately upstream: Spacer/protospacer = ATTCAGTCCTGACGGTTACCGAG → take exactly 20: TCAGTCCTGACGGTTACCGAG...

Accept any correct answer of the form: 20 nt directly 5′ of a valid NGG. Model answer: PAM = TGG; protospacer (sense) = CCTGACGGTTACCGAGTGG-region — the 20 nt = GATTCAGTCCTGACGGTTAC CGAG...

• Award: identifies a valid NGG PAM (1); picks exactly 20 nt immediately 5′ of it (2); states Cas9 cuts ~3 bp upstream of the PAM (blunt DSB) and gRNA matches the strand carrying the PAM/protospacer (1).

(Marker note: any grammatically valid 20-nt + adjacent NGG selection earns full marks; check the chosen 20-mer really abuts an NGG.)

(c) (2):

• The PAM-proximal seed region (~8–12 nt next to PAM) must base-pair first and correctly for R-loop propagation/nuclease activation. (1)
• A seed mismatch blocks stable pairing → no activation → no cut; a distal mismatch still allows seed pairing and R-loop completion, so cutting can still occur. (1)

Question 4 (10)

(a) (5):

• NHEJ: directly re-ligates broken ends; error-prone → random indels → frameshift/premature stop → gene knockout. (2.5)
• HDR: uses a supplied donor template with homology arms; copies donor sequence into break → precise insertion/edit → enables knock-in. (2.5)
• (Award causal reasoning: NHEJ disrupts reading frame; HDR templates new sequence.)

(b) (5):

• Cas9 nickase (dCas9/nCas9) fused to a cytidine deaminase. (1)
• Cas9 (guided by gRNA) binds target, exposing the non-target strand as ssDNA (R-loop), without making a DSB. (1)
• Deaminase converts C → U on the exposed ssDNA. (1)
• Uracil glycosylase inhibitor (UGI) blocks removal of U by base-excision repair, stabilising it. (1)
• Replication/repair reads U as T → final edit C•G → T•A; nickase nicks the non-edited strand to bias repair toward the edited base. (1)

Question 5 (8)

(a) (4) — 1 each:

• DNA's phosphate backbone is negatively charged. (1)
• In an electric field it migrates toward the positive electrode (anode). (1)
• The gel matrix sieves fragments; smaller fragments move faster/farther, larger move less. (1)
• Migration distance is inversely related to fragment size (∝ log of size). (1)

(b) (4):

• Each band = an allele; child inherits one allele per locus from each parent. (1)
• Child bands: 4, 6, 9. Mother has 4 (and 7). The 4 kb band is from the mother. (1)
• The remaining paternal bands 6 and 9 kb must come from the father. Alleged father has 6, 9 (and 11). (1)
• All of the child's non-maternal bands are present in the alleged father → father is NOT excluded (consistent with paternity). (1)

Question 6 (6)

(a) (3):

• Somatic: edits body (non-reproductive) cells; affects only the treated patient; not heritable. (1.5)
• Germline: edits gametes/embryos; change present in all cells and passed to offspring — heritable. (1.5)

(b) (3):

• For (1.5): e.g. could permanently prevent transmission of a severe heritable disease across generations (eradicate disease from lineage). Justified as reducing suffering.
• Against (1.5): e.g. affects individuals who cannot consent (future generations); risk of off-target/unknown effects; slippery slope to non-therapeutic "enhancement"/inequity. Justified by autonomy/safety/justice concerns.

[
  {"claim":"PCR yields 2^30 copies from 1 template after 30 cycles = 1073741824",
   "code":"n=30; copies=2**n; result = (copies == 1073741824)"},
  {"claim":"2^n doubling model gives ~1.07e9 at n=30 (within 1% of 1.07e9)",
   "code":"val=2**30; result = abs(val-1.07e9)/1.07e9 < 0.01"},
  {"claim":"Child non-maternal bands (6,9) are subset of alleged father's bands (6,9,11) -> not excluded",
   "code":"child={4,6,9}; mother={4,7}; father={6,9,11}; paternal=child-mother; result = paternal.issubset(father)"},
  {"claim":"A 20-nt spacer plus 3-nt NGG PAM spans 23 nt of target site",
   "code":"spacer=20; pam=3; result = (spacer+pam == 23)"}
]